Feeds:
Posts
Comentários

Posts Tagged ‘Biologia’

1 – (PUC-MG) Estado de Roraima foi assolado por uma queimada de proporções gigantescas. Considerando que, após as queimadas, essas áreas sejam preservadas, o que ocorre, ao longo do tempo, com a produtividade líquida e a biomassa, é, respectivamente:

a) aumenta; diminui.

b) fica constante; aumenta.

c) diminui; aumenta.

d) fica constante nos dois casos.

e) diminui, nos dois casos.

 

2 – (PUC-MG) Bioindicador é um termo que se usa para determinados seres vivos que indicam as qualidades ambientais de um determinado local. São melhores bioindicadores os seres vivos:

a) sensíveis, apenas, às modificações das condições bióticas do meio.

b) que têm grande resistência às alterações do ambiente.

c) que interagem o menos possível com o ambiente.

d) sensíveis às pequenas variações das condições ambientais.

e) endêmicos e com baixo contingente populacional.

 

3 – (PUC-MG) Considere a seguinte teia ecológica:

Sem título

Considerando I como produtor, marque a afirmativa CORRETA:

a) Se eliminarmos IV, as populações de I, II e III não sofrem qualquer alteração.

b) Eliminando-se IV, a população de I inicialmente aumenta.

c) Eliminando-se III, a população de II e IV, inicialmente, diminui.

d) Aumentando-se a população de III e IV, a população de I, inicialmente, aumenta.

e) Se eliminarmos II, as populações de III e IV não sofrem qualquer alteração.

 

 4 – (UFPE) Cada alternativa abaixo discorre sobre uma área específica do Brasil, identificada com a mesma letra da alternativa. Assinale a alternativa cuja associação e descrição estão corretas.

Sem título

a) O desmatamento pode levar ao empobrecimento do solo, tornando-o inadequado para a agricultura, pois este solo não é rico em nutrientes, devido à rápida degradação e ao reaproveitamento da matéria orgânica que cai no solo concentrando-se no corpo das plantas.

b) Ecossistema praticamente extinto devido à exploração descontrolada da madeira.

c) Região quente com solos ácidos, pobres em minerais e com grande quantidade de alumínio útil para agricultura, desde que fertilizado e corrigido em sua acidez pela adição de calcário.

d) Apesar de sua flora estar preservada, a fauna possui espécies em extinção como a ararinha-azul.

e) Denomina-se mata dos cocais onde o babaçu é explorado e a carnaúba produz cera.

 

 5 – (PUC-RJ) A decomposição constitui um processo ecológico presente em todos os ecossistemas, sejam eles naturais ou estejam eles sob controle do homem.

Dentre as opções abaixo, destaque a afirmativa FALSA:

a) O esgoto doméstico não se decompõe em rios não poluídos.

b) Uma das dificuldades em se usar resíduos produzidos pelo homem é a freqüente presença de metais pesados em altas concentrações.

c) A decomposição desempenha um papel reduzido na agricultura moderna e intensiva.

d) A liberação de nutrientes pela decomposição do esgoto pode estimular o crescimento de algas nos corpos d’água onde é lançado.

e) O arraste de nutrientes oriundos da agricultura ou de esgotos pode levar à redução do nível de oxigênio na água, em função da proliferação de algas e organismos.

 

 6 – (PUC-RJ) Em fevereiro de 1996, ocorreu no Rio de Janeiro um temporal de proporções jamais antes registradas, com centenas de desabamentos nas encostas do Maciço da Tijuca, alguns causando vítimas fatais e prejuízos de enorme monta.

Todas as afirmativas abaixo incluem características da floresta que recobre esse maciço, EXCETO:

a) Os poluentes atmosféricos e as queimadas contribuem para a redução da área florestada.

b) Os desabamentos ocorreram em função da inadaptabilidade das espécies arbóreas às chuvas mais intensas.

c) A flora do Maciço da Tijuca é altamente diversificada, com muitas espécies endêmicas.

d) As queimadas, provocadas principalmente pelos balões, favorecem o desenvolvimento do capim-colonião, o que pode levar à desestabilização das encostas.

e) A floresta da do Maciço da Tijuca é um exemplo típico da mata atlântica do Sudeste.

 

 7 – (PUC-RJ) Por meio de mutações ou recombinações eventuais as plantas podem produzir substâncias que as tornam menos apetecíveis aos insetos. Estes, por sua vez, podem evoluir em resposta a essas substâncias, com o desenvolvimento de linhagens imunes, que teriam vantagem adaptativa sobre as demais. Esse processo é conhecido como:

a) parasitismo.

b) escravagismo.

c) co-evolução.

d) inquilinismo.

e) alelopatia.

 

8 – (PUC-RJ) A maior parte dos rios que deságuam na Baía de Guanabara apresenta elevada carga de poluição, em função da grande densidade populacional existente na sua bacia contribuinte. No entanto, a carga de poluição pode variar, já que esta depende da proporção existente entre a quantidade de poluentes e a vazão do rio que a recebe. A diferença na qualidade de água do rio São João de Meriti (extremamente poluído) e do rio Guapimirim (pouco poluído) – ambos desaguando na Baía de Guanabara – ilustra esta . Neste sentido, considerando-se:

I – a vazão do rio,

II – a quantidade de poluentes que este recebe,

III – a poluição do rio,

constata-se que:

a) se I aumenta e II é constante, III tende a diminuir.

b) se II reduz e I aumenta, III tende a aumentar.

c) se I diminui e II é constante, III tende a diminuir.

d) se I e II aumentam, III tende a diminuir.

e) se I e II diminuem, III tende a aumentar.

 

9 – (PUC-RJ) Considere as afirmativas abaixo:

I – Devido à eutrofização das lagunas costeiras, numerosas espécies têm desaparecido em conseqüência do aumento da produção de algas adaptadas à poluição.

II – As restingas se desenvolvem sobre solos argilosos e de alta fertilidade e constituem o ecossistema mais preservado de todos os demais.

III – O manguezal é um ecossistema que apresenta espécies adaptadas às baixas concentrações de oxigênio no solo.

IV – Dos ecossistemas do Rio de Janeiro, o de maior extensão é a mata atlântica e o de menor extensão são os campos de altitude.

Das afirmativas acima, admitem-se como verdadeiras as indicadas na opção:

a) as afirmativas I e III.

b) as afirmativas I, III e IV.

c) as afirmativas I, II e IV.

d) as afirmativas II e III.

e) as afirmativas II e III e IV.

 

 10 – (UFPA) A eutroficação natural de um rio ou lago é um processo causado pelo acúmulo gradual de nutrientes que acarreta um aumento no número de organismos na água. Nas últimas décadas, entretanto, a eutroficação de muitos corpos de água tem sido acelerada pela poluição orgânica. Este processo é preocupante para os órgãos públicos que administram os recursos hídricos do país pois pode causar

a) obstrução nas raízes das plantas, reduzindo a capacidade de absorção de nutrientes das mesmas, levando à morte dos vegetais.

b) a diminuição da quantidade de oxigênio da água e, consequentemente, o colapso do sistema aquático.

c) a diminuição da quantidade de elementos vitais para as plantas, como o nitrogênio e fósforo, prejudicando o processo de fotossíntese.

d) a morte dos vertebrados aquáticos devido ao acúmulo de metais pesados nos seus organismos.

e) o aumento do número de predadores que causaria o desequilíbrio da cadeia trófica

 

 

Gabarito:

1-c 2-d 3-d 4-a 5-a 6-b 7-c 8-a 9-b 10-b

Read Full Post »

21/11/2015

Cibele Castro

  1. (UECE – 2013.1 2ª FASE) Analise as seguintes afirmações sobre as organelas celulares, e assinale com V as verdadeiras e com F as falsas:

( ) O retículo endoplasmático é formado a partir da invaginação da membrana plasmática, e está relacionado com a produção de proteínas e lipídios.

( ) As enzimas dos lisossomos podem digerir componentes de uma célula, transformando um tipo celular em outro, como uma forma bastante eficiente e econômica de reaproveitamento de matéria orgânica.

( ) Os ribossomos são organelas formadas por duas subunidades do mesmo tamanho, responsáveis pela síntese de lipídios.

( ) Nas mitocôndrias, durante o processo de respiração aeróbia, ocorrem as seguintes reações determinantes: o Ciclo de Krebs nas cristas mitocondriais e a Cadeia Respiratória na matriz mitocondrial.

A sequência correta, de cima para baixo, é:

A) V, F, F, V.

B) F, V, V, F.

C) V, V, F, F.

D) F, F, V, V.

 

  1. (UECE – 2013.1 2ª FASE) As ilhas Galápagos foram fundamentais para os estudos de Charles Darwin, pois foi lá que ele observou parte das espécies que inspiraram sua revolucionária teoria. Em sua obra, Darwin defende que as características tornam-se favoráveis, à medida que, hereditariamente, são transmitidas para as gerações seguintes. Esse mecanismo se enquadra no conceito de

A) origem das espécies.

B) evolução.

C) mutação.

D) seleção natural.

 

  1. (UECE – 2013.1 2ª FASE) A digestão transforma as moléculas grandes e complexas dos alimentos em outras, pequenas, simples e solúveis. O alimento degradado é o provedor da energia necessária a todo trabalho realizado pelo organismo, inclusive o da digestão. Partindo-se da premissa de que esse mecanismo (mecânico e químico) é imprescindível à vida, assinale a opção correta quanto ao processo da fisiologia da digestão humana.

A) Um polissacarídeo, como o amido, só pode ser utilizado após ser desdobrado em muitas moléculas de glicose. As proteínas, que são macromoléculas, devem ser desdobradas até seus aminoácidos constituintes.

B) A digestão abrange processos mecânicos e químicos. Os primeiros correspondem à preparação e à mistura dos alimentos com carboidratos para a efetivação da digestão química e às etapas químicas de digestão, que dependem da produção e da ação de complexos lipídios e de outras substâncias auxiliares.

C) Ao longo do intestino delgado ocorrem as etapas finais do desdobramento das substâncias pela ação do suco entérico, que contém várias glucidases (lactose, maltose, sacarose), além de lipases e peptidases. São estas últimas que desdobram os peptídeos em proteínas.

D) A chegada de alimento ao estômago faz com que células da sua mucosa produzam um hormônio, a pepsina, a qual, por via sanguínea, é levada às glândulas gástricas, estimulando-as a produzir suco gástrico.

 

  1. (UECE – 2013.1 2ª FASE) Quanto às características gerais dos seres vivos, assinale a

opção correta.

A) A célula eucariota apresenta uma membrana nuclear ou carioteca.

B) Todos os seres vivos, inclusive os vírus, são constituídos por unidades conhecidas como células.

C) As mutações consistem na alteração de uma ou mais características dos seres vivos, ocasionada por alterações em um ou mais genes, porém, sem alterações nos cromossomos.

D) Os seres vivos estão em constante atividade e isso os obriga a um consumo permanente de energia e devido a esse fato são todos obrigatoriamente consumidores.

 

  1. (UECE – 2014.2 2ª FASE) A membrana plasmática, também chamada de membrana celular, consiste em um envoltório composto por fosfolipídios e proteínas encontradas em todas as células vivas. Nos vegetais, o reforço externo dessa membrana é:

A) rígido, quitinoso e denominado de parede celular.

B) rígido, celulósico e impermeável quando impregnado de suberina.

C) elástico, celulósico e responsável pela proteção das células vegetais.

D) elástico, celulósico e de natureza exclusivamente proteica.

 

  1. (UECE – 2014.2 2ª FASE) As moléculas que possuem regiões capazes de interagir com moléculas de água e uma região onde não há essa interação (região hidrofóbica) recebem a

denominação de moléculas anfipáticas. Dentre as moléculas listadas abaixo, assinale a opção que corresponde à molécula anfipática que tem importante papel nas atividades celulares, como a capacidade seletiva.

A) glicose

B) fosfolipídios

C) ácidos graxos

D) colesterol

 

  1. (UECE – 2013.2 2ª FASE) O ácido L-ascórbico apresenta grande importância para sistemas bioquímicos, farmacológicos, eletroquímicos, processamento de alimentos e outros, sendo suas propriedades redox uma das características químicas de maior interesse. Sobre esse ácido, é correto afirmar-se que

A) vitamina K é o termo frequentemente usado para referência ao ácido L-ascórbico.

B) o ácido ascórbico, ou vitamina B6, apresenta várias funções importantes no corpo, estando envolvido no metabolismo de vários tecidos e em múltiplos processos bioquímicos.

C) alguns estudos concluem que a absorção de íons ferro, especialmente quando complexado com glicina, é favorecida em presença de ácido ascórbico (vitamina K) devido à reação de óxido-redução.

D) o ácido ascórbico previne o escorbuto, é importante na defesa do organismo contra infecções e fundamental na integridade das paredes dos vasos sanguíneos. É essencial para a formação das fibras colágenas existentes em praticamente todos os tecidos do corpo humano: derme, cartilagem e ossos.

 

  1. (UECE – 2013.2 2ª FASE) Analise as seguintes afirmações a respeito das substâncias que compõem os seres vivos:

I – Vitaminas são as melhores fontes de energia para os seres vivos, mas somente são encontradas nos alimentos saudáveis.

II – Além de sua função energética, os carboidratos também atuam como elementos estruturais e de proteção nos seres vivos.

III. Alguns hormônios sexuais dependem da existência de gordura para um funcionamento ideal.

IV- Seres vivos são constituídos exclusivamente por substâncias orgânicas como proteínas, lipídios, carboidratos, vitaminas e ácidos nucleicos.

Está correto o que se afirma apenas em

A) I e II.

B) II e III.

C) III e IV.

D) I e IV.

 

  1. (UECE – 2013.2 2ª FASE) A anemia falciforme decorre de uma mutação específica no gene da betaglobina que é um tipo de hemoglobina denominada de hemoglobina S. Os indivíduos que possuem a hemoglobina S apresentam quadros periódicos de febre e dor, pelo fato de a hemoglobina S formar longos cristais quando as concentrações de oxigênio estão abaixo do normal. Então, essa cristalização interfere na estrutura da membrana celular, provocando o rompimento da célula. Adicionalmente, estas células que sofreram lise podem causar o entupimento das veias, levando o indivíduo à morte. Abaixo estão os dois pedaços do gene da beta globina. A primeira sequência corresponde ao DNA de um indivíduo normal; a segunda sequência corresponde ao DNA de um indivíduo com anemia falciforme.

 

1ª Sequência normal da hemoglobina:

ATGGTGCACCTGACTCCTGTGGAGAAGTCTGCCGTTAC

TGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGT

GGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAG

ACAGGTTTAAGGAGACCAATAGAAACTGGGCATGT

 

2ª Sequência da hemoglobina com a mutação – anemia falciforme:

ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTAC

TGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGT

GGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAG

ACAGGTTTAAGGAGACCAATAGAAACTGGGCATGT

 

Para a tradução desses genes, é (são) necessário(s)

A) somente o mRNA.

B) a fita complementar do DNA e o mRNA.

C) somente o mRNA e o rRNA.

D) DNA, mRNA; tRNA e rRNA.

 

  1. (UECE – 2014.1 2ª FASE) No mecanismo da transcrição, uma das fitas do DNA (a fita molde) é transcrita em RNA mensageiro pela ação de:

A) um peptídeo sinalizador iniciador.

B) dois RNAs ribossômicos acoplados.

C) uma enzima denominada RNA polimerase dependente de DNA.

D) uma associação de RNAs ribossômicos com vários RNAs transportadores.

 

  1. (UECE – 2014.1 2ª FASE) Sobre o modelo mosaico fluido das membranas celulares, é correto afirmar-se que

A) os componentes mais abundantes da membrana são fosfolipídios, proteínas e aminoácidos livres.

B) a membrana tem constituição glicoproteica.

C) lipídios formam uma camada única e contínua, no meio da qual se encaixam moléculas de proteína.

D) a dupla camada de fosfolipídios é fluida, possui consistência oleosa, e as proteínas mudam de posição continuamente, como se fossem peças de um mosaico.

 

  1. (UECE – 2014.2 2ª FASE) Se uma determinada mutação maléfica ao humano é expressa por um gene recessivo ligado ao cromossoma X, a chance de uma mulher portadora dessa mutação, ao casar com homem não afetado, ter filhos afetados é de

A) 100%.

B) 75%.

C) 25%.

D) 50%.

 

  1. (UECE – 2015.1 2ª FASE) A probabilidade de heterozigotos a partir de um cruzamento entre indivíduos heterozigotos é de

A) 100%.

B) 50%.

C) 25%.

D) 75%.

 

  1. (UECE – 2015.1 2ª FASE) A cada nascimento de um ser humano a probabilidade de ser do sexo feminino ou do sexo masculino é representada corretamente pela seguinte porcentagem:

A) 100%.

B) 75%.

C) 25%.

D) 50%.

 

  1. (UECE – 2015.2 2ª FASE) O quilo, produto da digestão, é composto pelos nutrientes transformados em moléculas muito pequenas, mais as vitaminas e sais minerais. As substâncias que formam o quilo podem ser absorvidas pelo organismo, por meio das vilosidades do intestino delgado. Uma amostra de quilo retirada do intestino de uma mulher que havia almoçado mostrou-se rica em aminoácidos e glicose, portanto é possível inferir acertadamente que essa pessoa alimentou-se de:

A) proteínas e ácidos graxos.

B) lipídios e amido.

C) lipídios e carboidratos.

D) proteínas e carboidratos.

 

 

GABARITO

  1. C | 2. D | 3. A | 4. A |  5. B |  6. B |  7. D |  8. B |  9. D |  10. C |  11. C |  12.C |  13.B |  14.A |15.D

Fonte: http://www.uece.br/uecevest/index.php/noticias/43869-2015-11-20-19-53-32

Read Full Post »

1 – (PUC-PR) Com relação aos tecidos animais e vegetais, que formam os seres vivos, podemos dizer:

I – O tecido muscular formado por miofibrilas de proteínas tem como função a contração, produzindo os movimentos.

II – São tecidos conjuntivos o tecido ósseo, o tecido cartilaginoso e o tecido nervoso.

III – O parênquima paliçadico e o parênquima lacunoso constituem tecido vegetal sem clorofila.

IV – O meristema é um tecido vegetal de crescimento.

V – O tecido epitelial constitui no homem a pele e as glândulas.

São verdadeiras:

a) Apenas I e II.

b) Apenas I, IV e V.

c) Apenas I, II, IV e V.

d) Apenas IV e V.

e) Todas.


– (PUC-MG) sisal é uma planta muito cultivada no nordeste brasileiro. Suas folhas possuem uma fibra muito resistente, que é utilizada na confecção de cordas e tapetes. Essas fibras são formadas, principalmente, por:

a) colênquima.

b) parênquima.

c) floema.

d) esclerênquima.

e) epiderme.


– (PUC-MG) O tecido conjuntivo hemocitopoético é responsável pela:

a) formação, maturação e liberação das células do sangue.

b) síntese de fibras colágenas que entrarão na composição do tecido ósseo.

c) conexão entre a terminação do axônio e as fibrilas musculares nas placas motoras.

d) recomposição de células epiteliais em processos de cicatrização.

e) reabsorção de tecido ósseo.


– (UFPE) Em uma prova prática de histologia, os alunos examinaram 4 amostras de tecido e encontraram as características descritas no quadro abaixo:

AMOSTRA 1

Células grandes que apresentam corpo
Celular e prolongamentos; substância intercelular praticamente inexistente

AMOSTRA 2

Células fusiformes extremamente diferen-ciadas

AMOSTRA 3

Células imersas em substância intercelular viscosa e gelatinosa, com fibras colágenas dispostas em feixes sem orientação determinada

AMOSTRA 4

Células prismáticas e justapostas, com pouca substância intercelular

Dentre as alternativas abaixo assinale a que apresenta os tipos de tecidos que correspondem, respectivamente, às características das amostras 1, 2, 3 e 4.

a) adiposo, conjuntivo, epitelial e muscular

b) nervoso, muscular , conjuntivo, epitelial

c) conjuntivo , nervoso, epitelial e adiposo

d) nervoso, muscular, epitelial e conjuntivo

e) conjuntivo, nervoso, epitelial e muscular


5 – (PUC-RJ) Nas plantas, um tecido formado por células indiferenciadas e com intensa atividade mitótica é o:

a) floema.

b) meristema.

c) colênquima.

d) parênquima.

e) esclerênquima

– (PUC-RJ) A exposição prolongada da pele humana aos raios solares pode levar pessoas – especialmente as de pele clara – a desenvolver o câncer de pele. Dentre as alternativas abaixo, escolha a correta:

a) Os raios de sol na região tropical oferecem menor perigo de desenvolvimento de câncer de pele do que na região equatorial.

b) A proteção da pele contra raios ultravioletas se deve, entre outros fatores, à presença de melanina.

c) O tecido adiposo protege o corpo contra os raios solares.

d) A camada de queratina, situada profundamente na pele, facilita o transporte de água através da sudorese.e) A camada de queratina tem como finalidade filtrar os raios solares. 


– (PUC-PR) Ao microscópio óptico, ao ser observado um certo tecido, em corte transversal, foi possível identificar as seguintes características citológicas:

I – Células vivas.

II – Membranas celulósicas cutinizadas.

III – Citoplasma sem cloroplasto.

IV – Células intimamente unidas.

Baseado nessas características, podemos afirmar:

a) É epiderme vegetal.

b) Pode se tratar de um tecido animal.

c) Corresponde ao floema responsável pelo transporte da seiva elaborada.

d) É o meristema primário responsável pelo crescimento do vegetal.

e) É o meristema secundário responsável pelo crescimento do vegetal em espessura.

– (PUC-PR) Relacione as estruturas vegetais com as suas funções específicas e, a seguir, assinale a alternativa correta.

ESTRUTURA

I – Vasos liberianos

II – Tecido lacunoso

III – Colênquima

IV – Células especializadas da epiderme

V – Fibras esclerenquimáticas

FUNÇÃO

a) Transporte de água e sais minerais

b) Circulação de ar e fotossíntese

c) Eliminação de água sob a forma líquida

d) Aumento da superfície de absorção da água e sais minerais

e) Sustentação e flexibilidade

a) I-a, II-b, III-c.

b) I-b, II-d, IV-a.

c) III-e, IV-b, V-a.

d) II-b, III-e, IV-d.

e) II-c, III-a, IV-e.

– (PUC-RS) As células conhecidas por macrófagos têm importante papel nos mecanismos de defesa do nosso organismo. Elas fagocitam bactérias, restos celulares e partículas que penetram em nosso corpo. Essas células são características do tecido

a) ósseo.

b) conjuntivo.

c) epitelial.

d) nervoso.

e) muscular.

10 – (PUC-MG) Observe o desenho esquemático da pele humana e seus anexos.


Pelo desenho, é CORRETO concluir que sua origem embrionária é:

a) ectodérmica e mesodérmica.

b) ectodérmica e endodérmica.

c) mesodérmica e endodérmica.

d) somente ectodérmica.

e) somente mesodérmica.

Gabarito:
1-b 2-d 3-a 4-b 5-b 6-b 7-a 8-d 9-b 10-a

Read Full Post »

1 – (UFPE) Observe a figura abaixo, que mostra alguns detalhes da estrutura celular.


Assinale as afirmativas verdadeiras e as afirmativas falsas.

00) Representa uma célula vegetal, pois o aparelho mitótico não contém centrólos.

11) No centro (A), encontramos a formação do retículo endoplasmático rugoso que, uma vez instalado, promoverá o processo de síntese protéica da célula.

22) Representação de uma célula binucleada, comum entre os vegetais inferiores.

33) A migração de vesículas para a região central (A) da célula dará início ao processo de divisão cotoplasmática, por estrangulamento.

44) As moléculas de DNA (ácido desoxirribonucléico) encontram-se desespiralizadas para que sejam promovidos os processos de ativação metabólica celular.

2(FESP) Analise o esquema abaixo, representativo de tecido de revestimento da traquéia. Considere as afirmativas referentes a organóides citoplasmáticos e células secretoras, responsáveis pela síntese e secreção da camada de muco. Assinale as afirmativas verdadeiras e as afirmativas falsas.


00) O retículo endoplasmático liso é o responsável pela síntese da camada mucóide, composta de anticorpos.

11) Células secretoras, condrócitos, secretam o muco, sinal de envelhecimento do tecido.

22) O muco tem um papel protetor e é sintetizado e secretado pelo Complexo de Golgi das células secretoras.

33) Os lisossomos primários fabricam polissacarídeos que formam os cílios protetores do epitélio.

44) O Complexo de Golgi de células caliciformes é o local de formação das glico-proteínas que revestem as células das vias respiratórias.


3(UNICAP) Assinale as afirmativas verdadeiras e as afirmativas falsas.

00) A célula é a menor unidade viva com autonomia morfológica e funcional.

11) Diz-se que uma célula é procariótica quando só apresenta metade do número de cromossomos da espécie.

22) É graças à permeabilidade seletiva que a membrana celular consegue regular as trocas entre o meio interno da célula e o meio ambiente.

33) Os centríolos são estruturas celulares assim denominadas por se encontrar no centro do núcleo e ter função relacionada com a divisão celular.

44) O retículo endoplasmático transporta as proteínas produzidas pelos ribossomos.

4(UNICAP) Assinale as afirmativas verdadeiras e as afirmativas falsas.

00) O ADN é a única substância química, até agora conhecida, capaz de se auto-reproduzir, crescer e se modificar.

11) Células diplóides são aquelas que apresentam 2n cromossomos, como as células somáticas e as germinativas, antes de realizarem o processo meiótico.

22) A meiose difere de mitose por apresentar uma profáse mais longa e dividida em subfases e a cariocinese anteceder a citocinese.

33) Quando os cromossomos são acrocêntricos, a migração polar ocorre sem a formação do fuso acromático.

44) Nas células vegetais, a divisão do citoplasma resulta da formação da lamela média e não de um estrangulamento na região equatorial.

5(UNICAP) Assinale as afirmativas verdadeiras e as afirmativas falsas.

00) As células são as unidades morfológicas e fisiológicas dos seres vivos e podem ser procarióticas ou eucarióticas.

11) O angstron (Ã) foi introduzido na microscopia óptica como unidade de medida em virtude do crescente aperfeiçoamento tecnológico, para permitir melhor descrição dos componente celulares.

22) Organelas citoplasmáticas são estruturas permanentes das células que desempenham funções definidas; por exemplo, retículo endoplasmático, plastos, vacúolos e inclusões.

33) A célula vegetal, além da membrana plasmática, apresenta a parede celular primária e ainda pode apresentar parede celular secundária resultante de deposição de lignina e de suberina.

44) O nucléolo é um corpúsculo delimitado por uma membrana, sempre presente nas células eucarióticas e só identificável por ocasião da mitose.

6(UNICAP) Assinale as afirmativas verdadeiras e as afirmativas falsas.

00) Quatro nucleotídeos diferentes formam a molécula do ADN, sendo que três variedades deste ADN (ADN-r, ADN-t e ADN-m) estão implicados na síntese das proteínas.

11) O rendimento energético da respiração é de 38 ATP, assim dividido: 2 ATP na glicólise, 2 ATP no ciclo de Krebs e 34 ATP na cadeia respiratória.

22) Caritótipo é um conjunto de informações relativas ao tamanho, forma o número de cromossomos de uma espécie.

33) Os períodos da interfase são, pela ordem, denominados G1-S-G2 e as fases da mitose são prófase, metáfase, anáfase e telófase.

44) A interfase se caracteriza pela pouca atividade metabólica desempenhada pela célula.

7 – (UFPE) Em relação aos processos de transportes através da membrana, não é correto afirmar que:

a) a diferença entre difusão simples e difusão facilitada é que a primeira é um processo passivo, enquanto a segunda representa um tipo de transporte ativo;

b) transporte passivo refere-se ao movimento do soluto da região de maior concentração para a de menor concentração;

c) transporte ativo é caracterizado por ocorrer contra um gradiente de concentração e consumir energia;

d) a osmose é um transporte passivo;

e) a fagocitose é um processo que envolve a ingestão de materiais sólidos em blocos, pela célula.

8(UFPE) A respeito das células procarióticas, qual das alternativas abaixo está errada?

a) Não apresentam um núcleo verdadeiro.

b) Não possuem um sistema de membrana internas.

c) Não apresentam ribossomos.

d) São representadas pelas bactérias e algas azuis.

e) Não apresentam cloroplastos.

9 – (FESP) Os esquemas numerados com algarismos romanos representam fases da mitose. Assinale a alternativa que indica a seqüência correta das fases desse tipo de divisão celular.


a) I, IV, II, III

b) II, IV, I, III

c) I, IV, III, II

d) IV, II, I, III

e) III, II, I, IV


10 – (FESP) O núcleo interfásico contém o material genético determinante dos caracteres hereditários, de cada espécie animal ou vegetal. Sobre ele, abaixo, estão apresentadas algumas afirmativas:

I. Durante a interfase o núcleo é grande produtor de RNA.
II. Cromatina é considerada uma associação de DNA com proteínas.
III. O número de poros da carioteca aumenta com a atividade metabólica da célula.
IV.
Eucromatina corresponde às regiões de cromatina que aparecem condensadas e sem atividade genética.
V. Células do tecido muscular esquelético são mononucleares e as do tecido muscular liso são multinucleadas.

Estão corretas:

a) I, III e V

b) I, II e III

c) III, IV e V

d) I, IV e V

e) II, IV e V


Gabarito:
1-vfffv 2-ffvfv 3-vfvfv 4-vvvfv 5-vffvf 6-fvvvf 7-a 8-c 9-b 10-b

Read Full Post »

Biologia – Síntese de Proteínas.


Read Full Post »

Biologia – Fotossíntese.

Read Full Post »

1 – (PUC-RS)

Por sua particularidade estrutural, o fruto representado acima se enquadra como

a) folículo.

b) drupa.

c) aquênio.

d) baga.

e) vagem.

2 – (PUC-RS) As flores são os elementos que possibilitam a multiplicação das plantas fanerogâmicas. Para tanto, exibem uma série de estruturas relacionadas à reprodução, como o androceu, que representa um conjunto de

a) carpelos.

b) sépalas.

c) gavinhas.

d) pétalas.

e) estames.

3 – (PUC-MG) Se quisermos obter o protalo de uma pteridófita isosporada, devemos isolar:

a) o arquegônio.

b) os anterozóides.

c) o zigoto.

d) o esporo.

e) o gametófito.

4 – (PUC-MG) Leia as afirmativas abaixo, relativas aos hormônios produzidos por vegetais superiores:

I. A auxina é um hormônio relacionado ao crescimento, sendo sintetizado nas regiões de maior atividade, a exemplo dos meristemas.

II. As giberelinas são encontradas em todos os órgãos e também estão envolvidas no crescimento do vegetal.

III. A queima de plantas libera um hormônio de natureza gasosa, o etileno, responsável pelo amadurecimento de frutos.

A afirmativa está CORRETA em:

a) I, II e III.

b) I e II, apenas.

c) I e III, apenas.

d) II e III, apenas.

e) II, apenas.

5 – (PUC-RS)

As plantas que vivem em ambientes permanentemente alagados e de substratos não muito firmes desenvolvem adaptações que lhes permitem uma vida normal nesses lugares.

É o que mostra a figura acima em que aparecem raízes

a) estranguladoras.

b) tabulares.

c) sugadoras.

d) respiratórias.

e) escoras.

6 – (PUC-RS) A professora apresentou aos alunos a seguinte tarefa: trazer um exemplar de uma espécie qualquer de angiosperma que apresentasse como características:

I. corpo rico em aerênquima;

II. epiderme muito pouco diferenciada;

III. caule com poucos feixes liberolenhosos;

IV. sistema
radicial do tipo fasciculado com raízes muito finas e compridas.

Com grande probabilidade, cumpriu essa tarefa o aluno que procurou essa planta em um ambiente

a) rochoso.

b) desértico.

c) aquático.

d) subterrâneo.

e) arenoso.

7 – (PUC-RJ) Na maioria dos casos, a localização dos estômatos das plantas em cavidades representa uma adaptação destas para sobreviver em ambientes:

a) de água salobra.

b) pantanosos.

c) secos.

d) tropicais.

e) aquáticos

8 – (UFRN) Leia o fragmento que segue, extraído de Asa Branca (Luís Gonzaga e Humberto Teixeira):

Que braseiro, que fornaia,

Nem um pé de prantação,

Por farta d’água, perdi meu gado, Morreu de sede meu alazão…

As espécies vegetais típicas do contexto geográfico focalizado acima apresentam as seguintes adaptações:

a) rápido mecanismo de abertura e fechamento de estômatos – folhas cerificadas

b) presença de estruturas foliares modificadas em espinhos – raízes adventícias

c) aumento significativo da superfície foliar – raízes com alto poder absortivo

d) capacidade de armazenamento de água – associação de micorrizas

9 – (UFRN) Quando a planta é podada, geralmente as gemas laterais se desenvolvem por que:

a) a produção de citocinina aumenta, principalmente nos ramos podados.

b) a planta passa a ser estimulada pelo etileno liberado pela região ferida.

c) a planta passa a produzir ácido giberélico, para haver abscisão foliar.

d) a perda da dominância apical reduz a concentração da auxina.

10 – (PUC-MG) São pseudofrutos, EXCETO:

a) Caju.

b) Maçã.

c) Morango.

d) Amora.

e) Pêssego.

Gabarito:
1-b 2-e 3-d 4-a 5-e 6-c 7-c 8-a 9-d 10-e

Read Full Post »

Older Posts »