Feeds:
Posts
Comentários

Posts Tagged ‘UECE’

PROVAS PASSADAS UECE

 

Provas de Conhecimentos Gerais  – 2008.1
Provas Gabaritos
Prova Inglês 01. Gabarito Geral.
Prova Espanhol 01.
Prova Frances.

2010.2

Manual do Candidato.

Provas de Conhecimentos Gerais.

Inglês – 1° Fase
Provas Gabaritos
Prova 01. Gabarito Preliminar.

Gabarito Oficial.

Prova 02.
Prova 03.
Prova 04.
Espanhol – 1° Fase
Provas Gabaritos
Prova 01. Gabarito Preliminar.

Gabarito Oficial.

Prova 02.
Prova 03.
Prova 04.
Anúncios

Read Full Post »

Download Aqui!

Fonte: http://www.uece.br/uecevest/index.php/noticias/43882-2016-02-24-22-53-39

Read Full Post »

21/11/2015

Cibele Castro

  1. (UECE – 2013.1 2ª FASE) Analise as seguintes afirmações sobre as organelas celulares, e assinale com V as verdadeiras e com F as falsas:

( ) O retículo endoplasmático é formado a partir da invaginação da membrana plasmática, e está relacionado com a produção de proteínas e lipídios.

( ) As enzimas dos lisossomos podem digerir componentes de uma célula, transformando um tipo celular em outro, como uma forma bastante eficiente e econômica de reaproveitamento de matéria orgânica.

( ) Os ribossomos são organelas formadas por duas subunidades do mesmo tamanho, responsáveis pela síntese de lipídios.

( ) Nas mitocôndrias, durante o processo de respiração aeróbia, ocorrem as seguintes reações determinantes: o Ciclo de Krebs nas cristas mitocondriais e a Cadeia Respiratória na matriz mitocondrial.

A sequência correta, de cima para baixo, é:

A) V, F, F, V.

B) F, V, V, F.

C) V, V, F, F.

D) F, F, V, V.

 

  1. (UECE – 2013.1 2ª FASE) As ilhas Galápagos foram fundamentais para os estudos de Charles Darwin, pois foi lá que ele observou parte das espécies que inspiraram sua revolucionária teoria. Em sua obra, Darwin defende que as características tornam-se favoráveis, à medida que, hereditariamente, são transmitidas para as gerações seguintes. Esse mecanismo se enquadra no conceito de

A) origem das espécies.

B) evolução.

C) mutação.

D) seleção natural.

 

  1. (UECE – 2013.1 2ª FASE) A digestão transforma as moléculas grandes e complexas dos alimentos em outras, pequenas, simples e solúveis. O alimento degradado é o provedor da energia necessária a todo trabalho realizado pelo organismo, inclusive o da digestão. Partindo-se da premissa de que esse mecanismo (mecânico e químico) é imprescindível à vida, assinale a opção correta quanto ao processo da fisiologia da digestão humana.

A) Um polissacarídeo, como o amido, só pode ser utilizado após ser desdobrado em muitas moléculas de glicose. As proteínas, que são macromoléculas, devem ser desdobradas até seus aminoácidos constituintes.

B) A digestão abrange processos mecânicos e químicos. Os primeiros correspondem à preparação e à mistura dos alimentos com carboidratos para a efetivação da digestão química e às etapas químicas de digestão, que dependem da produção e da ação de complexos lipídios e de outras substâncias auxiliares.

C) Ao longo do intestino delgado ocorrem as etapas finais do desdobramento das substâncias pela ação do suco entérico, que contém várias glucidases (lactose, maltose, sacarose), além de lipases e peptidases. São estas últimas que desdobram os peptídeos em proteínas.

D) A chegada de alimento ao estômago faz com que células da sua mucosa produzam um hormônio, a pepsina, a qual, por via sanguínea, é levada às glândulas gástricas, estimulando-as a produzir suco gástrico.

 

  1. (UECE – 2013.1 2ª FASE) Quanto às características gerais dos seres vivos, assinale a

opção correta.

A) A célula eucariota apresenta uma membrana nuclear ou carioteca.

B) Todos os seres vivos, inclusive os vírus, são constituídos por unidades conhecidas como células.

C) As mutações consistem na alteração de uma ou mais características dos seres vivos, ocasionada por alterações em um ou mais genes, porém, sem alterações nos cromossomos.

D) Os seres vivos estão em constante atividade e isso os obriga a um consumo permanente de energia e devido a esse fato são todos obrigatoriamente consumidores.

 

  1. (UECE – 2014.2 2ª FASE) A membrana plasmática, também chamada de membrana celular, consiste em um envoltório composto por fosfolipídios e proteínas encontradas em todas as células vivas. Nos vegetais, o reforço externo dessa membrana é:

A) rígido, quitinoso e denominado de parede celular.

B) rígido, celulósico e impermeável quando impregnado de suberina.

C) elástico, celulósico e responsável pela proteção das células vegetais.

D) elástico, celulósico e de natureza exclusivamente proteica.

 

  1. (UECE – 2014.2 2ª FASE) As moléculas que possuem regiões capazes de interagir com moléculas de água e uma região onde não há essa interação (região hidrofóbica) recebem a

denominação de moléculas anfipáticas. Dentre as moléculas listadas abaixo, assinale a opção que corresponde à molécula anfipática que tem importante papel nas atividades celulares, como a capacidade seletiva.

A) glicose

B) fosfolipídios

C) ácidos graxos

D) colesterol

 

  1. (UECE – 2013.2 2ª FASE) O ácido L-ascórbico apresenta grande importância para sistemas bioquímicos, farmacológicos, eletroquímicos, processamento de alimentos e outros, sendo suas propriedades redox uma das características químicas de maior interesse. Sobre esse ácido, é correto afirmar-se que

A) vitamina K é o termo frequentemente usado para referência ao ácido L-ascórbico.

B) o ácido ascórbico, ou vitamina B6, apresenta várias funções importantes no corpo, estando envolvido no metabolismo de vários tecidos e em múltiplos processos bioquímicos.

C) alguns estudos concluem que a absorção de íons ferro, especialmente quando complexado com glicina, é favorecida em presença de ácido ascórbico (vitamina K) devido à reação de óxido-redução.

D) o ácido ascórbico previne o escorbuto, é importante na defesa do organismo contra infecções e fundamental na integridade das paredes dos vasos sanguíneos. É essencial para a formação das fibras colágenas existentes em praticamente todos os tecidos do corpo humano: derme, cartilagem e ossos.

 

  1. (UECE – 2013.2 2ª FASE) Analise as seguintes afirmações a respeito das substâncias que compõem os seres vivos:

I – Vitaminas são as melhores fontes de energia para os seres vivos, mas somente são encontradas nos alimentos saudáveis.

II – Além de sua função energética, os carboidratos também atuam como elementos estruturais e de proteção nos seres vivos.

III. Alguns hormônios sexuais dependem da existência de gordura para um funcionamento ideal.

IV- Seres vivos são constituídos exclusivamente por substâncias orgânicas como proteínas, lipídios, carboidratos, vitaminas e ácidos nucleicos.

Está correto o que se afirma apenas em

A) I e II.

B) II e III.

C) III e IV.

D) I e IV.

 

  1. (UECE – 2013.2 2ª FASE) A anemia falciforme decorre de uma mutação específica no gene da betaglobina que é um tipo de hemoglobina denominada de hemoglobina S. Os indivíduos que possuem a hemoglobina S apresentam quadros periódicos de febre e dor, pelo fato de a hemoglobina S formar longos cristais quando as concentrações de oxigênio estão abaixo do normal. Então, essa cristalização interfere na estrutura da membrana celular, provocando o rompimento da célula. Adicionalmente, estas células que sofreram lise podem causar o entupimento das veias, levando o indivíduo à morte. Abaixo estão os dois pedaços do gene da beta globina. A primeira sequência corresponde ao DNA de um indivíduo normal; a segunda sequência corresponde ao DNA de um indivíduo com anemia falciforme.

 

1ª Sequência normal da hemoglobina:

ATGGTGCACCTGACTCCTGTGGAGAAGTCTGCCGTTAC

TGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGT

GGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAG

ACAGGTTTAAGGAGACCAATAGAAACTGGGCATGT

 

2ª Sequência da hemoglobina com a mutação – anemia falciforme:

ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTAC

TGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGT

GGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAG

ACAGGTTTAAGGAGACCAATAGAAACTGGGCATGT

 

Para a tradução desses genes, é (são) necessário(s)

A) somente o mRNA.

B) a fita complementar do DNA e o mRNA.

C) somente o mRNA e o rRNA.

D) DNA, mRNA; tRNA e rRNA.

 

  1. (UECE – 2014.1 2ª FASE) No mecanismo da transcrição, uma das fitas do DNA (a fita molde) é transcrita em RNA mensageiro pela ação de:

A) um peptídeo sinalizador iniciador.

B) dois RNAs ribossômicos acoplados.

C) uma enzima denominada RNA polimerase dependente de DNA.

D) uma associação de RNAs ribossômicos com vários RNAs transportadores.

 

  1. (UECE – 2014.1 2ª FASE) Sobre o modelo mosaico fluido das membranas celulares, é correto afirmar-se que

A) os componentes mais abundantes da membrana são fosfolipídios, proteínas e aminoácidos livres.

B) a membrana tem constituição glicoproteica.

C) lipídios formam uma camada única e contínua, no meio da qual se encaixam moléculas de proteína.

D) a dupla camada de fosfolipídios é fluida, possui consistência oleosa, e as proteínas mudam de posição continuamente, como se fossem peças de um mosaico.

 

  1. (UECE – 2014.2 2ª FASE) Se uma determinada mutação maléfica ao humano é expressa por um gene recessivo ligado ao cromossoma X, a chance de uma mulher portadora dessa mutação, ao casar com homem não afetado, ter filhos afetados é de

A) 100%.

B) 75%.

C) 25%.

D) 50%.

 

  1. (UECE – 2015.1 2ª FASE) A probabilidade de heterozigotos a partir de um cruzamento entre indivíduos heterozigotos é de

A) 100%.

B) 50%.

C) 25%.

D) 75%.

 

  1. (UECE – 2015.1 2ª FASE) A cada nascimento de um ser humano a probabilidade de ser do sexo feminino ou do sexo masculino é representada corretamente pela seguinte porcentagem:

A) 100%.

B) 75%.

C) 25%.

D) 50%.

 

  1. (UECE – 2015.2 2ª FASE) O quilo, produto da digestão, é composto pelos nutrientes transformados em moléculas muito pequenas, mais as vitaminas e sais minerais. As substâncias que formam o quilo podem ser absorvidas pelo organismo, por meio das vilosidades do intestino delgado. Uma amostra de quilo retirada do intestino de uma mulher que havia almoçado mostrou-se rica em aminoácidos e glicose, portanto é possível inferir acertadamente que essa pessoa alimentou-se de:

A) proteínas e ácidos graxos.

B) lipídios e amido.

C) lipídios e carboidratos.

D) proteínas e carboidratos.

 

 

GABARITO

  1. C | 2. D | 3. A | 4. A |  5. B |  6. B |  7. D |  8. B |  9. D |  10. C |  11. C |  12.C |  13.B |  14.A |15.D

Fonte: http://www.uece.br/uecevest/index.php/noticias/43869-2015-11-20-19-53-32

Read Full Post »

Arquivo Original

Professoras elaboradoras: FLAVIANNE CORTEZ E LORENAMATOS

 

Proposta 1

 Com base na leitura dos seguintes textos motivadores e nos conhecimentos construídos ao longo de sua formação, redija um texto dissertativo-argumentativo em norma culta escrita da Língua Portuguesa sobre o tema “Invasão humana nos habitats de outros animais: desequilíbrio no ecossistema”.

Selecione, organize e relacione, de forma coerente e coesa, argumentos e fatos para a defesa

do seu ponto de vista, sem ferir os direitos humanos.

 

Texto 1

Plástico polui oceanos e prejudica diversos animais marinhos

Pesquisa feita pelo Projeto Tamar revela que, de cada 10 tartarugas mortas, quatro morreram, porque ingeriram lixo.

Do golfinho que tinha mais de dois metros de comprimento sobrou só o esqueleto. Quando apareceu na praia, no sul do Espírito Santo, já estava sem forças para reagir.

“Um pedaço de plástico estava no estômago, o outro, no esôfago. Aos poucos, o animal deixou de se alimentar, foi ficando desnutrido e morreu por inanição, que foi a causa da morte”, explica Lupércio Barbosa, coordenador do Instituto Orca.Ele era de uma espécie rara, um golfinho de dentes rugosos.

Foi mais uma vítima do lixo.“Jogar um plástico do carro na rua, vai cair no bueiro e isso vai parar no mar “, alerta Lupércio.Imagine uma cidade cortada pelo mar, com toda beleza que isso representa, e,ainda por cima, sem lixo jogado no lugar errado. Não é fácil encontrar um lugar assim. Olhando de fora parece mesmo bem bonito, mas por outro ângulo a esperança vai afundando. É assim normalmente em trechos de mar que cortam centros urbanos.

No fundo do canal de Guarapari, no Espírito Santo, o lixo não desaparece. Resiste ao tempo e se mistura à vida marinha, insistente.“A sujeira realmente incomoda bastante, a gente tenta jogar para baixo do tapete, mas quando você desce dá para ver que está ali”, conta o mergulhador Bruno Zippinotti.Garfo de plástico, faca, garrafa. “Até muito longe da terra a gente encontra lixo flutuando que vem do continente. Isso afeta o meio ambiente, afeta a comunidade, porque diminui o turismo na área”, diz o mergulhador Júlio Yaber.

A sujeira vem das cidades litorâneas, mas pode aparecer muito mais longe, a centenas de quilômetros da praia. No Rio Doce, que corta mais de 200 cidades de Minas Gerais e Espírito Santo, é só acompanhar o trajeto da água para ver o tamanho do problema. No local a gente encontra garrafa de plástico, embalagem de óleo lubrificante, detergente e xampu. É lixo que segue adiante e vai parar no mar, provocando um efeito devastador.“Eu já vi peixe com sacola enrolada na goela, já vi garrafa pet agarrada na goela do peixe também”, relata o pescador Zé de Sabino.

“As tartarugas confundem o lixo com alimento. E ela vai comer e pode morrer”, diz a estudante Kerly Maciel.

Uma pesquisa feita em 2009 pelo Projeto Tamar em cinco estados brasileiros – Ceará, Sergipe, Bahia, Espírito Santo, São Paulo e Santa Catarina – revela que de cada 10 tartarugas mortas, quatro morreram porque ingeriram lixo. Dentro de uma única tartaruga verde encontrada no litoral capixaba tinha plástico de todo jeito e tamanho, pedaço de canudo e até tampa de garrafa pet. “Essa quantidade de lixo para um animal pequeno, um animal que tinha por volta de quatro anos, isso é fatal”, explica Henrique Filgueiras, coordenador do Projeto Tamar em Regência, no Espírito Santo.

O bicho confunde o plástico com o seu alimento, as algas, e o material não é digerido, fica no estômago do animal impedindo que se alimente. Além disso, ele não consegue mais afundar, tem dificuldade para respirar. Precisa de tratamento urgente, à base de soro. Uma papa verde, mistura de peixe e couve, é para o animal já mais forte, que tenta sobreviver.“Pode ser que ela contribua para eliminar esse lixo que tiver, se a obstrução não for muito grande já, não for muito severa”, conta a veterinária Jéssica Ribeiro.

Um documentário francês mostra a sopa de plástico que viraram os oceanos. No Mar Mediterrâneo há três milhões de toneladas de lixo. O plástico tomou conta do mar, está na superfície e até a mil metros de profundidade.

Disponível em: http://www.globalgarbage.org/blog/index.php/2010/01/11/animais-marinhos-sofremcom-lixo-no-oceano/

Acessado: dia 17/08/2015

 

 

Texto 2

Sem título

Disponível em: https://www.google.com.br/search?q=animais+marinhos+lixo

Acessado: 17/08/2015

 
Texto 3

Animais icónicos que os humanos estão a levar à extinção

Lémures

Desde que os humanos chegaram a Madagáscar há cerca de 2.000 anos, cerca de 15 a 20 espécies de lémures foram extintos, provavelmente devido à perda de habitat e caça, incluindo espécies cujos machos cresceram até tamanhos semelhante aos dos gorilas, afirmou Paul Garver, da Universidade de Illinois.Mas isso foi ao longo de centenas e milhares de anos. Os seres humanos estão a reduzir ohabitat dos lémures em ritmo muito mais rápido agora. Como as populações humanas malgaxes sabem, eles ameaçam as demais espécies de lémures e milhares de outras espécies endémicas com extinção a um ritmo acelerado, disse Garber.

Atualmente, 93 espécies de lémures estão em perigo, criticamente em perigo ou ameaçadas,

principalmente devido ao desmatamento de florestas da ilha, de acordo com a União Internacional para  a Conservação da Natureza (IUCN), uma organização ambiental global – que é de 91% de todas as espécies de lémures.

 

Tubarões

Cerca de 100 milhões de tubarões são mortos todos os anos para serem transformados em sopa de barbatana de tubarão, uma iguaria chinesa. Este comércio tem a forma do finning, em que as barbatanas dos animais são cortados fora e eles são jogados de volta ao oceano para morrer lentamente. No entanto, o gosto da China pelo prato pode estar a cair: de acordo com o grupo ambientalista americano WildAid, o consumo da sopa está abaixo de 50 a 70% nos  últimos dois anos.No entanto, um terço dos tubarões e raias estão ameaçados de extinção, de acordo com um estudo de2009 feito pela IUCN. Por esta razão, a Convenção sobre o Comércio Internacional de Espécies Ameaçadas de Fauna e Flora Selvagens (CITES) votou, em março deste ano, a proibição do comércio de barbatanas de tubarão de cinco espécies ameaçadas. [Livescience]

Disponível em: http://www.ciencia-online.net/2013/12/7-animais-que-humanos-estao-a-extinguir.html

(adaptado)

Acessado: 17/08/2015

 

INSTRUÇÕES:

  • O rascunho da redação deve ser feito no espaço apropriado.
  • A redação com até 7 (sete) linhas escritas será considerada “insuficiente” e receberá nota zero.
  • A redação que fugir ao tema ou que não atender ao tipo dissertativo-argumentativo receberá nota zero.
  • A redação que apresentar proposta de intervenção que desrespeite os direitos humanos receberá nota zero.

 

 

Proposta 2

Texto I

Movimentos planejam protestos em todo o país e Aécio indica participação

Com a popularidade da presidente Dilma Rousseff em baixa e as crises econômica, política e ética cada vez mais acirradas, movimentos de oposição ao governo da petista saem às ruas neste domingo (16/8/15) em protestos programados para todo o país e também no exterior. O Movimento Brasil Livre espera manifestações em, pelo menos, 144 localidades, já o Vem Pra Rua lista 257 cidades em seu site, sendo 19 fora do Brasil. Além do ‘fora Dilma’, outro mote dos principais movimentos de rua contrários à atual gestão federal, que inclui também o Revoltados Online, é “não vamos pagar a conta do PT”.

Ao contrário dos protestos anteriores, quando o principal partido de oposição tentou manter uma certa neutralidade, neste domingo, o PSDB e seus principais aliados, como o DEM, PPS e Solidariedade, convocaram as pessoas para irem às ruas. O candidato derrotado do PSDB em 2014, Aécio Neves, sinalizou nesta sexta-feira (14/8/15) em Maceió, onde participa do lançamento da campanha nacional de filiação do seu partido, que vai participar das manifestações, mas não disse onde.

 Fonte: http://www.correiobraziliense.com.br/app/noticia/politica/2015/08/14/internas_polbraeco,494630/movimentos-planejam-protestos-em-todo-o-pais-e-aecio-indica-paticipacao.shtml

Acessado em: 17/08/2015

 

Texto II

 Todos os estados e o DF têm protestos contra o governo Dilma

Brasileiros foram às ruas neste domingo (16) em 205 cidades em todos os estados e no Distrito Federal em protesto contra o governo da presidente Dilma Rousseff (PT).

As manifestações levaram mais pessoas às ruas do que as de 12 abril, mas menos do que as de 15 março, segundo a polícia e os organizadores. A PM estimou em 879 mil o total de manifestantes deste domingo. Em abril, foram 701 mil e em março, 2,4 milhões.Considerando os números dos organizadores, participaram 2 milhões neste domingo, 1,5 milhão em abril e 3 milhões em março.

Grande parte dos manifestantes pedia a renúncia ou o impeachment da presidente e cobrava o fim da corrupção. Pela primeira vez, o ex-presidente Luiz Inácio Lula da Silva foi fortemente criticado. Muitos participantes vestiam verde amarelo e levavam bandeiras do Brasil. Também foram vistas faixas com referência à Operação Lava Jato e elogiando o juiz Sérgio Moro.

Na noite deste domingo, o Instituto Lula divulgou nota na qual afirmou que o ex-presidente jamais cometeu ilegalidades antes, durante ou depois de seus dois mandatos.

Fonte: http://g1.globo.com/politica/noticia/2015/08/manifestantes-protestam-contra-o-governo-dilma-emcidades-do-brasil.html

Acessado em: 17/08/2015

 

> A partir de seus conhecimentos acerca do tema e baseado nos textos motivadores, escreva um artigo de opinião sobre a influência das manifestações populares no cenário atual da política brasileira

 

Fonte: http://www.uece.br/uecevest/index.php/noticias/43809-2015-08-19-14-50-43 (Acessado em 29/09/2015)

Read Full Post »

21/09/2015 – Inscrição On-line

Período de inscrição: de 21 de setembro a 04 de outubro de 2015.

Link – http://www.uece.br/cev/index.php/vestibular-20161

Read Full Post »

A Comissão Executiva do Vestibular (CEV), da Universidade Estadual do Ceará (Uece), informa que o Resultado Final do Vestibular 2015.2 será divulgado até o dia 21 de agosto, após os julgamentos dos possíveis recursos que venham a ser interpostos questionando o Boletim e Correção da Prova de Redação.

No dia 7 de agosto, foi disponibilizado, por consulta individual, no site da CEV, o boletim de correção da Prova de Redação do Vestibular 2015.2.

O período para interposição de recurso administrativo questionando o resultado que consta no boletim de correção da Prova de Redação é de 17 a 18 de agosto.

Fonte: http://www.uece.br/uece/index.php/noticias/92532-resultado-do-vestibular-20152-sapi-ate-o-dia-21-de-agosto

Read Full Post »