Feeds:
Posts
Comentários

unnamed

1 – (PUC-MG) Estado de Roraima foi assolado por uma queimada de proporções gigantescas. Considerando que, após as queimadas, essas áreas sejam preservadas, o que ocorre, ao longo do tempo, com a produtividade líquida e a biomassa, é, respectivamente:

a) aumenta; diminui.

b) fica constante; aumenta.

c) diminui; aumenta.

d) fica constante nos dois casos.

e) diminui, nos dois casos.

 

2 – (PUC-MG) Bioindicador é um termo que se usa para determinados seres vivos que indicam as qualidades ambientais de um determinado local. São melhores bioindicadores os seres vivos:

a) sensíveis, apenas, às modificações das condições bióticas do meio.

b) que têm grande resistência às alterações do ambiente.

c) que interagem o menos possível com o ambiente.

d) sensíveis às pequenas variações das condições ambientais.

e) endêmicos e com baixo contingente populacional.

 

3 – (PUC-MG) Considere a seguinte teia ecológica:

Sem título

Considerando I como produtor, marque a afirmativa CORRETA:

a) Se eliminarmos IV, as populações de I, II e III não sofrem qualquer alteração.

b) Eliminando-se IV, a população de I inicialmente aumenta.

c) Eliminando-se III, a população de II e IV, inicialmente, diminui.

d) Aumentando-se a população de III e IV, a população de I, inicialmente, aumenta.

e) Se eliminarmos II, as populações de III e IV não sofrem qualquer alteração.

 

 4 – (UFPE) Cada alternativa abaixo discorre sobre uma área específica do Brasil, identificada com a mesma letra da alternativa. Assinale a alternativa cuja associação e descrição estão corretas.

Sem título

a) O desmatamento pode levar ao empobrecimento do solo, tornando-o inadequado para a agricultura, pois este solo não é rico em nutrientes, devido à rápida degradação e ao reaproveitamento da matéria orgânica que cai no solo concentrando-se no corpo das plantas.

b) Ecossistema praticamente extinto devido à exploração descontrolada da madeira.

c) Região quente com solos ácidos, pobres em minerais e com grande quantidade de alumínio útil para agricultura, desde que fertilizado e corrigido em sua acidez pela adição de calcário.

d) Apesar de sua flora estar preservada, a fauna possui espécies em extinção como a ararinha-azul.

e) Denomina-se mata dos cocais onde o babaçu é explorado e a carnaúba produz cera.

 

 5 – (PUC-RJ) A decomposição constitui um processo ecológico presente em todos os ecossistemas, sejam eles naturais ou estejam eles sob controle do homem.

Dentre as opções abaixo, destaque a afirmativa FALSA:

a) O esgoto doméstico não se decompõe em rios não poluídos.

b) Uma das dificuldades em se usar resíduos produzidos pelo homem é a freqüente presença de metais pesados em altas concentrações.

c) A decomposição desempenha um papel reduzido na agricultura moderna e intensiva.

d) A liberação de nutrientes pela decomposição do esgoto pode estimular o crescimento de algas nos corpos d’água onde é lançado.

e) O arraste de nutrientes oriundos da agricultura ou de esgotos pode levar à redução do nível de oxigênio na água, em função da proliferação de algas e organismos.

 

 6 – (PUC-RJ) Em fevereiro de 1996, ocorreu no Rio de Janeiro um temporal de proporções jamais antes registradas, com centenas de desabamentos nas encostas do Maciço da Tijuca, alguns causando vítimas fatais e prejuízos de enorme monta.

Todas as afirmativas abaixo incluem características da floresta que recobre esse maciço, EXCETO:

a) Os poluentes atmosféricos e as queimadas contribuem para a redução da área florestada.

b) Os desabamentos ocorreram em função da inadaptabilidade das espécies arbóreas às chuvas mais intensas.

c) A flora do Maciço da Tijuca é altamente diversificada, com muitas espécies endêmicas.

d) As queimadas, provocadas principalmente pelos balões, favorecem o desenvolvimento do capim-colonião, o que pode levar à desestabilização das encostas.

e) A floresta da do Maciço da Tijuca é um exemplo típico da mata atlântica do Sudeste.

 

 7 – (PUC-RJ) Por meio de mutações ou recombinações eventuais as plantas podem produzir substâncias que as tornam menos apetecíveis aos insetos. Estes, por sua vez, podem evoluir em resposta a essas substâncias, com o desenvolvimento de linhagens imunes, que teriam vantagem adaptativa sobre as demais. Esse processo é conhecido como:

a) parasitismo.

b) escravagismo.

c) co-evolução.

d) inquilinismo.

e) alelopatia.

 

8 – (PUC-RJ) A maior parte dos rios que deságuam na Baía de Guanabara apresenta elevada carga de poluição, em função da grande densidade populacional existente na sua bacia contribuinte. No entanto, a carga de poluição pode variar, já que esta depende da proporção existente entre a quantidade de poluentes e a vazão do rio que a recebe. A diferença na qualidade de água do rio São João de Meriti (extremamente poluído) e do rio Guapimirim (pouco poluído) – ambos desaguando na Baía de Guanabara – ilustra esta . Neste sentido, considerando-se:

I – a vazão do rio,

II – a quantidade de poluentes que este recebe,

III – a poluição do rio,

constata-se que:

a) se I aumenta e II é constante, III tende a diminuir.

b) se II reduz e I aumenta, III tende a aumentar.

c) se I diminui e II é constante, III tende a diminuir.

d) se I e II aumentam, III tende a diminuir.

e) se I e II diminuem, III tende a aumentar.

 

9 – (PUC-RJ) Considere as afirmativas abaixo:

I – Devido à eutrofização das lagunas costeiras, numerosas espécies têm desaparecido em conseqüência do aumento da produção de algas adaptadas à poluição.

II – As restingas se desenvolvem sobre solos argilosos e de alta fertilidade e constituem o ecossistema mais preservado de todos os demais.

III – O manguezal é um ecossistema que apresenta espécies adaptadas às baixas concentrações de oxigênio no solo.

IV – Dos ecossistemas do Rio de Janeiro, o de maior extensão é a mata atlântica e o de menor extensão são os campos de altitude.

Das afirmativas acima, admitem-se como verdadeiras as indicadas na opção:

a) as afirmativas I e III.

b) as afirmativas I, III e IV.

c) as afirmativas I, II e IV.

d) as afirmativas II e III.

e) as afirmativas II e III e IV.

 

 10 – (UFPA) A eutroficação natural de um rio ou lago é um processo causado pelo acúmulo gradual de nutrientes que acarreta um aumento no número de organismos na água. Nas últimas décadas, entretanto, a eutroficação de muitos corpos de água tem sido acelerada pela poluição orgânica. Este processo é preocupante para os órgãos públicos que administram os recursos hídricos do país pois pode causar

a) obstrução nas raízes das plantas, reduzindo a capacidade de absorção de nutrientes das mesmas, levando à morte dos vegetais.

b) a diminuição da quantidade de oxigênio da água e, consequentemente, o colapso do sistema aquático.

c) a diminuição da quantidade de elementos vitais para as plantas, como o nitrogênio e fósforo, prejudicando o processo de fotossíntese.

d) a morte dos vertebrados aquáticos devido ao acúmulo de metais pesados nos seus organismos.

e) o aumento do número de predadores que causaria o desequilíbrio da cadeia trófica

 

 

Gabarito:

1-c 2-d 3-d 4-a 5-a 6-b 7-c 8-a 9-b 10-b

“Inscrições de 30/11/2015 a 24/12/2015”
Descrição: CONCURSO PÚBLICO, DESTINADO A SELECIONAR CANDIDATOS, PARA O PROVIMENTO DE VAGAS E FORMAÇÃO DE CADASTRO DE RESERVA.

Edital; Download aqui!

  • Provas

Vigia: Download Aqui!

Assistente Social: Download Aqui!

Auxiliar de Serviços Gerais : Download Aqui!

Agente Administrativo: Download Aqui!

Guarda Municipal: Download Aqui!

Psicólogo: Download Aqui!

Secretário Escolar: Download Aqui!

Interprete de Libras: Download Aqui!

Educador Instrutor de Libras: Download Aqui!

Professor de Educação Básica – Ciências: Download Aqui!

Professor de Educação Básica – Língua Inglesa: Download Aqui!

Professor de Educação – Artes e Educação: Download Aqui!

Professor de Educação Básica – Polivalente: Download Aqui!

Professor de Educação Básica – Educação Física: Download Aqui!

Professor de Educação Básica – Matemática: Download Aqui!

Professor de Educação Básica – Língua Portuguesa: Download Aqui!

Professor de Educação Básica – História: Download Aqui!

Professor de Educação Básica – Geografia: Download Aqui!

Professor de Educação Básica – Educação Especial: Download Aqui!

Gabarito Definitivo: Download Aqui!

 

 

 

 

Fonte: http://www.grserv.com.br/index.php?menu=concursos&acao=ver&id=34

Download Aqui!

Fonte: http://www.uece.br/uecevest/index.php/noticias/43882-2016-02-24-22-53-39

O Instituto Federal do Ceará segue com sua política de ampliação das oportunidades de qualificação para todos os cearenses, por meio de cursos de qualidade e gratuitos. Em nova seleção, a Instituição abriu mais 615 vagas contemplando, com cursos técnicos integrados, concomitantes e subsequentes, os campi de Fortaleza e de Sobral. As inscrições começam no dia 09 e seguem até 25 de março de 2016, apenas por meio do site: http://qselecao.ifce.edu.br/lista_concursos.aspx

 

O pedido de isenção da taxa de inscrição, por aqueles que preenchem os critérios estabelecido em edital, pode ser feito em qualquer uma das unidades  participante ( Fortaleza e Sobral) do processo de seleção, no período de 9 a 16 de março de 2016, no horário de 8 às 12 horas e de 13 às 17 horas. Antes de efetuar a inscrição, o candidato deverá ler com atenção todo o edital, disponível: http://qselecao.ifce.edu.br e se certificar que atende a todos os requisitos necessários para a inscrição.

 

Os cursos abertas contemplam várias áreas, por exemplo: Edificações, Mecânica Indústria, Telecomunicações, Instrumento Musical, Segurança do Trabalho, Panificação, Agroindústria, Eletrotécnica e Meio Ambiente. Para afastar quaisquer dúvidas quanto à modalidade de ensino, dispusemos abaixo as características de cada uma:

 

Cursos Técnicos Concomitantes: podem se inscrever, para esta modalidade de ensino, estudantes que no ato da matrícula apresentem comprovante de matrícula no Ensino Médio. São cursos de formação técnica de nível médio, ofertados a quem está cursando o ensino médio tradicional e no contra turno irá cursar o ensino técnico no Instituto Federal. Este estudante só receberá o diploma de técnico mediante a apresentação do certificado de conclusão do ensino médio.

 

Cursos Técnicos Integrados: podem se inscrever, para esta modalidade de ensino, estudantes que no ato da matrícula apresentem comprovante de conclusão do Ensino Fundamental. São cursos técnicos, integrados ao ensino médio tradicional, planejados de modo a conduzir o aluno à habilitação profissional técnica de nível médio.

 

Cursos Técnicos Subsequentes: podem se inscrever, para esta modalidade de ensino, estudantes que no ato da matrícula apresentem comprovante de conclusão do Ensino Médio. São também cursos de formação técnica de nível médio, ofertados a quem já tenha concluído o Ensino Médio.

 

Por Antônio Alencar – reitoria

Fonte: https://ifce.edu.br/noticias/noticias-de-destaque/abertas-mais-615-vagas-em-cursos-tecnicos

21/11/2015

Cibele Castro

  1. (UECE – 2013.1 2ª FASE) Analise as seguintes afirmações sobre as organelas celulares, e assinale com V as verdadeiras e com F as falsas:

( ) O retículo endoplasmático é formado a partir da invaginação da membrana plasmática, e está relacionado com a produção de proteínas e lipídios.

( ) As enzimas dos lisossomos podem digerir componentes de uma célula, transformando um tipo celular em outro, como uma forma bastante eficiente e econômica de reaproveitamento de matéria orgânica.

( ) Os ribossomos são organelas formadas por duas subunidades do mesmo tamanho, responsáveis pela síntese de lipídios.

( ) Nas mitocôndrias, durante o processo de respiração aeróbia, ocorrem as seguintes reações determinantes: o Ciclo de Krebs nas cristas mitocondriais e a Cadeia Respiratória na matriz mitocondrial.

A sequência correta, de cima para baixo, é:

A) V, F, F, V.

B) F, V, V, F.

C) V, V, F, F.

D) F, F, V, V.

 

  1. (UECE – 2013.1 2ª FASE) As ilhas Galápagos foram fundamentais para os estudos de Charles Darwin, pois foi lá que ele observou parte das espécies que inspiraram sua revolucionária teoria. Em sua obra, Darwin defende que as características tornam-se favoráveis, à medida que, hereditariamente, são transmitidas para as gerações seguintes. Esse mecanismo se enquadra no conceito de

A) origem das espécies.

B) evolução.

C) mutação.

D) seleção natural.

 

  1. (UECE – 2013.1 2ª FASE) A digestão transforma as moléculas grandes e complexas dos alimentos em outras, pequenas, simples e solúveis. O alimento degradado é o provedor da energia necessária a todo trabalho realizado pelo organismo, inclusive o da digestão. Partindo-se da premissa de que esse mecanismo (mecânico e químico) é imprescindível à vida, assinale a opção correta quanto ao processo da fisiologia da digestão humana.

A) Um polissacarídeo, como o amido, só pode ser utilizado após ser desdobrado em muitas moléculas de glicose. As proteínas, que são macromoléculas, devem ser desdobradas até seus aminoácidos constituintes.

B) A digestão abrange processos mecânicos e químicos. Os primeiros correspondem à preparação e à mistura dos alimentos com carboidratos para a efetivação da digestão química e às etapas químicas de digestão, que dependem da produção e da ação de complexos lipídios e de outras substâncias auxiliares.

C) Ao longo do intestino delgado ocorrem as etapas finais do desdobramento das substâncias pela ação do suco entérico, que contém várias glucidases (lactose, maltose, sacarose), além de lipases e peptidases. São estas últimas que desdobram os peptídeos em proteínas.

D) A chegada de alimento ao estômago faz com que células da sua mucosa produzam um hormônio, a pepsina, a qual, por via sanguínea, é levada às glândulas gástricas, estimulando-as a produzir suco gástrico.

 

  1. (UECE – 2013.1 2ª FASE) Quanto às características gerais dos seres vivos, assinale a

opção correta.

A) A célula eucariota apresenta uma membrana nuclear ou carioteca.

B) Todos os seres vivos, inclusive os vírus, são constituídos por unidades conhecidas como células.

C) As mutações consistem na alteração de uma ou mais características dos seres vivos, ocasionada por alterações em um ou mais genes, porém, sem alterações nos cromossomos.

D) Os seres vivos estão em constante atividade e isso os obriga a um consumo permanente de energia e devido a esse fato são todos obrigatoriamente consumidores.

 

  1. (UECE – 2014.2 2ª FASE) A membrana plasmática, também chamada de membrana celular, consiste em um envoltório composto por fosfolipídios e proteínas encontradas em todas as células vivas. Nos vegetais, o reforço externo dessa membrana é:

A) rígido, quitinoso e denominado de parede celular.

B) rígido, celulósico e impermeável quando impregnado de suberina.

C) elástico, celulósico e responsável pela proteção das células vegetais.

D) elástico, celulósico e de natureza exclusivamente proteica.

 

  1. (UECE – 2014.2 2ª FASE) As moléculas que possuem regiões capazes de interagir com moléculas de água e uma região onde não há essa interação (região hidrofóbica) recebem a

denominação de moléculas anfipáticas. Dentre as moléculas listadas abaixo, assinale a opção que corresponde à molécula anfipática que tem importante papel nas atividades celulares, como a capacidade seletiva.

A) glicose

B) fosfolipídios

C) ácidos graxos

D) colesterol

 

  1. (UECE – 2013.2 2ª FASE) O ácido L-ascórbico apresenta grande importância para sistemas bioquímicos, farmacológicos, eletroquímicos, processamento de alimentos e outros, sendo suas propriedades redox uma das características químicas de maior interesse. Sobre esse ácido, é correto afirmar-se que

A) vitamina K é o termo frequentemente usado para referência ao ácido L-ascórbico.

B) o ácido ascórbico, ou vitamina B6, apresenta várias funções importantes no corpo, estando envolvido no metabolismo de vários tecidos e em múltiplos processos bioquímicos.

C) alguns estudos concluem que a absorção de íons ferro, especialmente quando complexado com glicina, é favorecida em presença de ácido ascórbico (vitamina K) devido à reação de óxido-redução.

D) o ácido ascórbico previne o escorbuto, é importante na defesa do organismo contra infecções e fundamental na integridade das paredes dos vasos sanguíneos. É essencial para a formação das fibras colágenas existentes em praticamente todos os tecidos do corpo humano: derme, cartilagem e ossos.

 

  1. (UECE – 2013.2 2ª FASE) Analise as seguintes afirmações a respeito das substâncias que compõem os seres vivos:

I – Vitaminas são as melhores fontes de energia para os seres vivos, mas somente são encontradas nos alimentos saudáveis.

II – Além de sua função energética, os carboidratos também atuam como elementos estruturais e de proteção nos seres vivos.

III. Alguns hormônios sexuais dependem da existência de gordura para um funcionamento ideal.

IV- Seres vivos são constituídos exclusivamente por substâncias orgânicas como proteínas, lipídios, carboidratos, vitaminas e ácidos nucleicos.

Está correto o que se afirma apenas em

A) I e II.

B) II e III.

C) III e IV.

D) I e IV.

 

  1. (UECE – 2013.2 2ª FASE) A anemia falciforme decorre de uma mutação específica no gene da betaglobina que é um tipo de hemoglobina denominada de hemoglobina S. Os indivíduos que possuem a hemoglobina S apresentam quadros periódicos de febre e dor, pelo fato de a hemoglobina S formar longos cristais quando as concentrações de oxigênio estão abaixo do normal. Então, essa cristalização interfere na estrutura da membrana celular, provocando o rompimento da célula. Adicionalmente, estas células que sofreram lise podem causar o entupimento das veias, levando o indivíduo à morte. Abaixo estão os dois pedaços do gene da beta globina. A primeira sequência corresponde ao DNA de um indivíduo normal; a segunda sequência corresponde ao DNA de um indivíduo com anemia falciforme.

 

1ª Sequência normal da hemoglobina:

ATGGTGCACCTGACTCCTGTGGAGAAGTCTGCCGTTAC

TGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGT

GGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAG

ACAGGTTTAAGGAGACCAATAGAAACTGGGCATGT

 

2ª Sequência da hemoglobina com a mutação – anemia falciforme:

ATGGTGCACCTGACTCCTGAGGAGAAGTCTGCCGTTAC

TGCCCTGTGGGGCAAGGTGAACGTGGATGAAGTTGGT

GGTGAGGCCCTGGGCAGGTTGGTATCAAGGTTACAAG

ACAGGTTTAAGGAGACCAATAGAAACTGGGCATGT

 

Para a tradução desses genes, é (são) necessário(s)

A) somente o mRNA.

B) a fita complementar do DNA e o mRNA.

C) somente o mRNA e o rRNA.

D) DNA, mRNA; tRNA e rRNA.

 

  1. (UECE – 2014.1 2ª FASE) No mecanismo da transcrição, uma das fitas do DNA (a fita molde) é transcrita em RNA mensageiro pela ação de:

A) um peptídeo sinalizador iniciador.

B) dois RNAs ribossômicos acoplados.

C) uma enzima denominada RNA polimerase dependente de DNA.

D) uma associação de RNAs ribossômicos com vários RNAs transportadores.

 

  1. (UECE – 2014.1 2ª FASE) Sobre o modelo mosaico fluido das membranas celulares, é correto afirmar-se que

A) os componentes mais abundantes da membrana são fosfolipídios, proteínas e aminoácidos livres.

B) a membrana tem constituição glicoproteica.

C) lipídios formam uma camada única e contínua, no meio da qual se encaixam moléculas de proteína.

D) a dupla camada de fosfolipídios é fluida, possui consistência oleosa, e as proteínas mudam de posição continuamente, como se fossem peças de um mosaico.

 

  1. (UECE – 2014.2 2ª FASE) Se uma determinada mutação maléfica ao humano é expressa por um gene recessivo ligado ao cromossoma X, a chance de uma mulher portadora dessa mutação, ao casar com homem não afetado, ter filhos afetados é de

A) 100%.

B) 75%.

C) 25%.

D) 50%.

 

  1. (UECE – 2015.1 2ª FASE) A probabilidade de heterozigotos a partir de um cruzamento entre indivíduos heterozigotos é de

A) 100%.

B) 50%.

C) 25%.

D) 75%.

 

  1. (UECE – 2015.1 2ª FASE) A cada nascimento de um ser humano a probabilidade de ser do sexo feminino ou do sexo masculino é representada corretamente pela seguinte porcentagem:

A) 100%.

B) 75%.

C) 25%.

D) 50%.

 

  1. (UECE – 2015.2 2ª FASE) O quilo, produto da digestão, é composto pelos nutrientes transformados em moléculas muito pequenas, mais as vitaminas e sais minerais. As substâncias que formam o quilo podem ser absorvidas pelo organismo, por meio das vilosidades do intestino delgado. Uma amostra de quilo retirada do intestino de uma mulher que havia almoçado mostrou-se rica em aminoácidos e glicose, portanto é possível inferir acertadamente que essa pessoa alimentou-se de:

A) proteínas e ácidos graxos.

B) lipídios e amido.

C) lipídios e carboidratos.

D) proteínas e carboidratos.

 

 

GABARITO

  1. C | 2. D | 3. A | 4. A |  5. B |  6. B |  7. D |  8. B |  9. D |  10. C |  11. C |  12.C |  13.B |  14.A |15.D

Fonte: http://www.uece.br/uecevest/index.php/noticias/43869-2015-11-20-19-53-32

1 – (PUC-MG) A água oxigenada, usada para desinfecção e para clarear cabelos, decompõe-se segundo a equação:


Considerando a decomposição completa de 100 mL de , o volume de gás oxigênio produzido, nas CNTP, é:

a) 1,12 L

b) 2,24 L

c) 11,2 L

d) 22,4 L

e) 112,0 L

2(UFF) Um meteorito de 4,5 bilhões de anos, que caiu numa cidadezinha do Texas, trouxe uma surpresa para os cientistas: “vestígio de água” (transcrito de “O Globo” 30/08/99).

Na investigação sobre a vida em outros planetas, procura-se verificar a existência ou não de água, pois, esta é elemento essencial à vida, nos moldes até agora conhecidos.

Considere a reação completa de 1,5 m3 de H2(g) com O2 à temperatura de 27 oC e pressão de 8,2 atm. Nestas condições, a massa de água produzida e o volume de O2 consumido são, respectivamente:

a) 1,80 kg e 15,00 m3

b) 4,50 kg e 3,00 m3

c) 9,00 kg e 0,75 m3

d) 18,00 kg e 1,50 m3

e) 45,00 kg e 30,00 m3


3 – (UFRN) Certa massa de gás ideal pode ser representada pela relação PV / T = constante, sendo P(pressão), V(volume), T(temperatura).

Pode-se afirmar que a pressão do gás aumenta quando

a) V aumenta e T diminui.

b) V não varia e T diminui.

c) T não varia e V aumenta.

d) T aumenta e V não varia.

4 – (PUC-MG) Sob condições apropriadas, gás acetileno (C2H2) e ácido clorídrico reagem para formar cloreto de vinila, C2H3Cl . Essa substância é usada para produzir policloreto de vinila (P.V.C) plástico e foi considerada recentemente carcinogênica. A reação na formação do C2H3Cl pode ser representada pela equação:

C2H2 + HCl C2H3Cl

Quando se obtêm 2 mols de cloreto de vinila, o volume de gás acetileno consumido, nas CNTP, é igual a:

a) 11,2 L

b) 22,4 L

c) 33,6 L

d) 44,8 L

e) 89,2 L

5 – (PUC-RJ) A camada de ozônio (O3) que envolve a Terra nos protege da radiação ultravioleta emitida pelo sol. Dentre os gases listados abaixo, assinale aquele que mais contribui para a destruição da camada de ozônio.

a) CO2

b) N2

c) O2

d) NO

e) Ar

6 – (UFCE) A presença de materiais indesejáveis no ar altera a composição da atmosfera terrestre, tornando-a praticamente irrespirável. Em São Paulo, foi realizado um rigoroso programa de racionamento do tráfego de veículos automotores, com o objetivo de diminuir os índices de poluição. Com relação a esse problema, escolha a alternativa correta:

a) o ar ideal para se respirar deve ser constituído somente de Oxigênio;

b) o ar ideal para se respirar deve ser constituído mais de Oxigênio do que de Nitrogênio;

c) o ar não poluído e adequado ao ser humano deve ser constituído de Nitrogênio, Oxigênio e Hidrogênio em partes iguais;

d) a atmosfera terrestre não poluída é constituída mais de Nitrogênio do que de Oxigênio;

e) a atmosfera ideal é uma mistura heterogênea formada de vapor d’água e Oxigênio.


7 – (PUC-RS) Um dos efeitos da chamada “chuva ácida” causada pelo SO2(g) lançado na atmosfera é a transformação do mármore, CaCO3(s), em gesso, CaSO4(s), que pode ser representado pelas seguintes equações:

2SO2(g) + O2(g) 2SO3(g)

SO3(g) + H2O ( l ) H2SO4(aq)

H2SO4(aq) + CaCO3(s) CaSO4(s) + H2O ( l ) + CO2(g)

A quantidade de gesso que pode ser formada, no máximo, pela reação de 44,8 litros de SO2 (g) lançado na atmosfera, nas CNTP, é

a) 34g

b) 68g

c) 136g

d) 272g

e) 340g

8 – (UFRN) Na figura abaixo, tem-se um gráfico de p.V (p=pressão; V=volume), no eixo das ordenadas, versus T, no eixo das abcissas, para 0,01 mol de um gás ideal.

 

 A inclinação dessa reta permite o cálculo da

a) densidade absoluta do gás.

b) constante universal dos gases.

c) pressão atmosférica

d) massa molar do gás.

9 – (UFRRJ) Tem-se 6L de um gás à pressão de 2,4 atmosferas. A pressão da mesma quantidade deste gás, quando seu volume for reduzido a 1/3, numa transformação isotérmica, será igual a

a) 7,2 atm.

b) 7,0 atm.

c) 2,7 atm.

d) 6,8 atm.

e) 8,6 atm.

10 – (UFRRJ) Um balão de oxigênio contendo 3,01×1026 átomos foi completamente utilizado por uma equipe médica durante uma cirurgia. Admitindo-se que havia apenas gás oxigênio neste balão, a massa utilizada do referido gás foi equivalente a

a) 8,0 kg.

b) 4,0 kg.

c) 12,0 kg.

d) 16,0 kg.

e) 10,0 kg.

Gabarito:
1-a 2-c 3-d 4-d 5-d 6-e 7-d 8-b 9-a 10-a